Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
Hsa_circ_0008274 | |||
Gene | UGGT2 | Organism | Human |
Genome Locus | chr11: 96485180-96489456:n/a | Build | hg19 |
Disease | Papillary Thyroid Carcinoma | ICD-10 | #N/A (D09.3) |
DBLink | Link to database | PMID | 28288173 |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | 8 thyroid samples, consisting of six PTC tumors, six matching contralateral normal samples, and six benign thyroid lesions |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGGGTGGAGTATGATGCTGA Reverse-CACACCAGGTTTCACACCAC | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Peng, N, Shi, L, Zhang, Q, Hu, Y, Wang, N, Ye, H (2017). Microarray profiling of circular RNAs in human papillary thyroid carcinoma. PLoS ONE, 12, 3:e0170287. |